Prev. | 

RIKEN DNA Bank Human Resource - RPS19BP1

Gene ID NCBI Gene 91582 |  KEGG hsa:91582
Gene Symbol RPS19BP1
Protein Name ribosomal protein S19 binding protein 1
Synonyms AROS|S19BP
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039454 IRAK098K14 pCMV-SPORT6 BC047711 NM_194326 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052522 ARe31F02 pKA1U5 NM_194326.2  
GGCGCCGCCATGTCCGCCGCCCTGCTGCGGCGGGGCCTGGAGCTGCTGGCGGCGTCCGAG
HKR361377 RBd03H09 pGCAP10 NM_194326.2  
GGGGCGGAGCCAAGCGCCGCCATGTCCGCCGCCCTGCTGCGGCGGGGCCTGGAGCTGCTG
HKR394906 RBd87E10 pGCAP10 NM_194326.2  
TGAAGCGCCGCCATGTCCGCCGCCCTGCTGCGGCGGGGCCTGGAGCTGCTGGCGGCGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl