Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04924

HP ID(1) HP04924
Gene ID(2) 114883
Gene Symbol finder OSBPL9
Protein Name oxysterol binding protein-like 9
RefSeq NM_148908.1
Length of RefSeq (bp) 2880
Chromosome 1p32.3
Reference DDBJ accession
UniGene Hs.21938

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe21E01 pKA1U5 GGTTTGTTGTCATTGGCGGCTCCCAAGATGGCNTCCATCATGGAAGGGCCGCTGAGCAAA
ARe32C08 pKA1U5 GGTCCCGGGGGACGGGCTGAACCTCAGTCAGGACCGCCTGCACCGCAGTCCGGGGATCGG
RBd23F07 pGCAP10 GAGTCCGGGGATCGGGTCGAGGGGAGAAGAAAAAGGGGTGCTCGGGAGCAGCCCCCGGCT
RBdS022K06 pGCAP10 GGTTTGTTGTCATTGGCGGCTCCCAAGATGGCGTCCATCATGGAAGGGCCGCTGAGCAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl