Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022K06

Clone ID RBdS022K06
HP ID HP04924
Gene ID 114883
Gene Symbol OSBPL9
Protein Name oxysterol binding protein-like 9
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_148908.1
Length of RefSeq (bp) 2880
Chromosome 1p32.3
Reference DDBJ accession
UniGene Hs.21938
5'-terminal sequence GGTTTGTTGTCATTGGCGGCTCCCAAGATGGCGTCCATCATGGAAGGGCCGCTGAGCAAA
2011.08.28