Prev. |  KEGG KO K20465 > 

RIKEN DNA Bank Human Resource - OSBPL9

Gene ID NCBI Gene 114883 |  KEGG hsa:114883
Gene Symbol OSBPL9
Protein Name oxysterol binding protein like 9
Synonyms ORP-9|ORP9
Ortholog resources KEGG ortholog (KEGG orthology K20465) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087439 IRAL018J23 pOTB7 BC006160 NM_148909 Partial
HGY089663 IRAL024C15 pOTB7 BC025978 NM_148905 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048497 ARe21E01 pKA1U5 NM_148908.1  
GGTTTGTTGTCATTGGCGGCTCCCAAGATGGCNTCCATCATGGAAGGGCCGCTGAGCAAA
HKR052856 ARe32C08 pKA1U5 NM_148908.1  
GGTCCCGGGGGACGGGCTGAACCTCAGTCAGGACCGCCTGCACCGCAGTCCGGGGATCGG
HKR369327 RBd23F07 pGCAP10 NM_148908.1  
GAGTCCGGGGATCGGGTCGAGGGGAGAAGAAAAAGGGGTGCTCGGGAGCAGCCCCCGGCT
HKR409046 RBdS022K06 pGCAP10 NM_148908.1  
GGTTTGTTGTCATTGGCGGCTCCCAAGATGGCGTCCATCATGGAAGGGCCGCTGAGCAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl