Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04791

HP ID(1) HP04791
Gene ID(2) 25941
Gene Symbol finder C18orf10
Protein Name chromosome 18 open reading frame 10
RefSeq NM_015476.2
Length of RefSeq (bp) 2079
Chromosome 18q12.2
Reference DDBJ accession
UniGene Hs.695999

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe11F03 pKA1U5 GGCATCCCGCCGCGCGCGAATCGCNGATCGCAAACCATTNNANCCAGCGATNCNTTNCTC
ARf05D01 pKA1U5 GACCGGGCGGGGCCGCGGGAACCGGCGCCCCACGGAGCTGCTGCTGTCAGACCAACCCCG
ARi05F04 pGCAP10 GAGACCAACCCCGGGCCCCCATCATCACTGCGCCGCGCTTTCAGGCGCCGAGAACTACCG
ARiS161H24 pGCAP10 GGCCCCCGCCTGCGCGGCCGGCCCCTGCGGGGCGAGAGGGTCGGGGCGAAGGGGAAGCTA
ARiS191O03 pGCAP10 GACCCGCTCCCGCCGCGCGCGAATCGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCC
RBb32G01 pGCAP1 GGCGCGAATCGCGGTCGCGAGCCATGGAGGAGGAGGCATCGCTCCCCGGGGCTGGGCTGC
RBd10C11 pGCAP10 CACCCGCTCCCGCCGCGCGCGAATCGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCC
RBd75C07 pGCAP10 GGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCCCGGGGCTGGGCTGCAGCAAGCCGC
RBd92G03 pGCAP10 GCCCGCCGCGCGCGAATCGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCCCGGGGCT
RBd93D04 pGCAP10 GGCGCGCGAATCGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCCCGGGGCTGGGCTG
RBdS015K05 pGCAP10 GCTGCGCGGCCGGCCCCTGCGGGGCGAGAGGGTCGGGGCGAAGGGGAAGCTACGTCCCGG
RBdS070K20 pGCAP10 GGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCCCGGGGCTGGGCTGCAGCAAGCCGC
RBdS070N13 pGCAP10 GGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCCCGGGGCTGGGCTGCAGCAAGCCGC
RBdS187A24 pGCAP10 GGCGCGAATCGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCCCGGGGCTGGGCTGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl