Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187A24

Clone ID RBdS187A24
HP ID HP04791
Gene ID 25941
Gene Symbol C18orf10
Protein Name chromosome 18 open reading frame 10
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015476.2
Length of RefSeq (bp) 2079
Chromosome 18q12.2
Reference DDBJ accession
UniGene Hs.695999
5'-terminal sequence GGCGCGAATCGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCCCGGGGCTGGGCTGCA
2011.08.28