Prev. |  KEGG KO K16605 > 

RIKEN DNA Bank Human Resource - TPGS2

Gene ID NCBI Gene 25941 |  KEGG hsa:25941
Gene Symbol TPGS2
Protein Name tubulin polyglutamylase complex subunit 2
Synonyms C18orf10|HMFN0601|L17|PGs2
Ortholog resources KEGG ortholog (KEGG orthology K16605) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX009004 IRAK022I12 pCMV-SPORT6 BC015178 NM_015476 Full
HGY084690 IRAL011M02 pOTB7 BC022199 NM_015476 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044523 ARe11F03 pKA1U5 NM_015476.2  
GGCATCCCGCCGCGCGCGAATCGCNGATCGCAAACCATTNNANCCAGCGATNCNTTNCTC
HKR082073 ARf05D01 pKA1U5 NM_015476.2  
GACCGGGCGGGGCCGCGGGAACCGGCGCCCCACGGAGCTGCTGCTGTCAGACCAACCCCG
HKR162124 ARi05F04 pGCAP10 NM_015476.2  
GAGACCAACCCCGGGCCCCCATCATCACTGCGCCGCGCTTTCAGGCGCCGAGAACTACCG
HKR264592 ARiS161H24 pGCAP10 NM_015476.2  
GGCCCCCGCCTGCGCGGCCGGCCCCTGCGGGGCGAGAGGGTCGGGGCGAAGGGGAAGCTA
HKR276739 ARiS191O03 pGCAP10 NM_015476.2  
GACCCGCTCCCGCCGCGCGCGAATCGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCC
HKR332945 RBb32G01 pGCAP1 NM_015476.2  
GGCGCGAATCGCGGTCGCGAGCCATGGAGGAGGAGGCATCGCTCCCCGGGGCTGGGCTGC
HKR364059 RBd10C11 pGCAP10 NM_015476.2  
CACCCGCTCCCGCCGCGCGCGAATCGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCC
HKR390055 RBd75C07 pGCAP10 NM_015476.2  
GGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCCCGGGGCTGGGCTGCAGCAAGCCGC
HKR396947 RBd92G03 pGCAP10 NM_015476.2  
GCCCGCCGCGCGCGAATCGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCCCGGGGCT
HKR397276 RBd93D04 pGCAP10 NM_015476.2  
GGCGCGCGAATCGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCCCGGGGCTGGGCTG
HKR406245 RBdS015K05 pGCAP10 NM_015476.2  
GCTGCGCGGCCGGCCCCTGCGGGGCGAGAGGGTCGGGGCGAAGGGGAAGCTACGTCCCGG
HKR428260 RBdS070K20 pGCAP10 NM_015476.2  
GGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCCCGGGGCTGGGCTGCAGCAAGCCGC
HKR428325 RBdS070N13 pGCAP10 NM_015476.2  
GGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCCCGGGGCTGGGCTGCAGCAAGCCGC
HKR474824 RBdS187A24 pGCAP10 NM_015476.2  
GGCGCGAATCGCGGTCGCGAGCCATGGAGGAGGAGGCATCGTCCCCGGGGCTGGGCTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl