Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04768

HP ID(1) HP04768
Gene ID(2) 79701
Gene Symbol finder C17orf101
Protein Name chromosome 17 open reading frame 101
RefSeq NM_024648.1
Length of RefSeq (bp) 1255
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.567578

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe09H12 pKA1U5 GACTCGCGTCCCTGCGCCGTGCCTGCCTCGCGCTCCCTGTTACGGCGTTCGTCCCCGGGC
RBb27C06 pGCAP1 GGGGGCCGATGGCCGAGCGCGTCGCACTCGCGTCCCTGCGCCGTGCCTGCCTCGCGCTCC
RBd59D05 pGCAP10 TTGGACTCGCGTCCCTGCGCCGTGCCTGCCTCGCGCTCCCTGTTACGGCGTTCGTCCCCG
RBdS040L18 pGCAP10 GGCGTCCCTGCGCCGTGCCTGCCTCGCGCTCCCTGTTACGGCGTTCGTCCCCGGGCCTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl