Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040L18

Clone ID RBdS040L18
HP ID HP04768
Gene ID 79701
Gene Symbol C17orf101
Protein Name chromosome 17 open reading frame 101
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_024648.1
Length of RefSeq (bp) 1255
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.567578
5'-terminal sequence GGCGTCCCTGCGCCGTGCCTGCCTCGCGCTCCCTGTTACGGCGTTCGTCCCCGGGCCTGG
2011.08.28