Prev. | 

RIKEN DNA Bank Human Resource - OGFOD3

Gene ID NCBI Gene 79701 |  KEGG hsa:79701
Gene Symbol OGFOD3
Protein Name 2-oxoglutarate and iron dependent oxygenase domain containing 3
Synonyms C17orf101
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085973 IRAL014P13 pOTB7 BC008897 NM_175902 Full/var
HGY093240 IRAL033B16 pOTB7 BC023602 NM_175902

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043780 ARe09H12 pKA1U5 NM_024648.1  
GACTCGCGTCCCTGCGCCGTGCCTGCCTCGCGCTCCCTGTTACGGCGTTCGTCCCCGGGC
HKR330854 RBb27C06 pGCAP1 NM_024648.1  
GGGGGCCGATGGCCGAGCGCGTCGCACTCGCGTCCCTGCGCCGTGCCTGCCTCGCGCTCC
HKR383677 RBd59D05 pGCAP10 NM_024648.1  
TTGGACTCGCGTCCCTGCGCCGTGCCTGCCTCGCGCTCCCTGTTACGGCGTTCGTCCCCG
HKR416282 RBdS040L18 pGCAP10 NM_024648.1  
GGCGTCCCTGCGCCGTGCCTGCCTCGCGCTCCCTGTTACGGCGTTCGTCCCCGGGCCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl