Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04566

HP ID(1) HP04566
Gene ID(2) 51608
Gene Symbol finder C7orf20
Protein Name chromosome 7 open reading frame 20
RefSeq NM_015949.2
Length of RefSeq (bp) 2106
Chromosome 7p22.3
Reference DDBJ accession
UniGene Hs.107387

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe30F06 pKA1U5 GGCCTGCGACAGCGTCAGCCCTGCGCGGAGCGCCGGCCCGATGGCGGCGGCGGCGGCGAT
ARiS013N21 pGCAP10 GGTAGAAGGGCGTCGGGCGGCCGTCGGGACGGAAGCCGGGAGGCGCTGCCGACCGCGCCT
RBd97A12 pGCAP10 GGAGGCGCTGCCGACCGCGCCTGCGACAGCGTCAGCCCTGCGCGGAGCGCCGGCCCGATG
RBdS022K15 pGCAP10 GGCGCGCCTGCGACAGCGTCAGCCCTGCGCGGAGCGCCGGCCCGATGGCGGCGGCGGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl