Prev. | 

RIKEN DNA Bank Human Resource - GET4

Gene ID NCBI Gene 51608 |  KEGG hsa:51608
Gene Symbol GET4
Protein Name golgi to ER traffic protein 4
Synonyms C7orf20|CEE|CGI-20|TRC35
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083528 IRAL008N16 pOTB7 BC003550 NM_015949 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052126 ARe30F06 pKA1U5 NM_015949.2  
GGCCTGCGACAGCGTCAGCCCTGCGCGGAGCGCCGGCCCGATGGCGGCGGCGGCGGCGAT
HKR205533 ARiS013N21 pGCAP10 NM_015949.2  
GGTAGAAGGGCGTCGGGCGGCCGTCGGGACGGAAGCCGGGAGGCGCTGCCGACCGCGCCT
HKR398812 RBd97A12 pGCAP10 NM_015949.2  
GGAGGCGCTGCCGACCGCGCCTGCGACAGCGTCAGCCCTGCGCGGAGCGCCGGCCCGATG
HKR409055 RBdS022K15 pGCAP10 NM_015949.2  
GGCGCGCCTGCGACAGCGTCAGCCCTGCGCGGAGCGCCGGCCCGATGGCGGCGGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl