Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022K15

Clone ID RBdS022K15
HP ID HP04566
Gene ID 51608
Gene Symbol C7orf20
Protein Name chromosome 7 open reading frame 20
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015949.2
Length of RefSeq (bp) 2106
Chromosome 7p22.3
Reference DDBJ accession
UniGene Hs.107387
5'-terminal sequence GGCGCGCCTGCGACAGCGTCAGCCCTGCGCGGAGCGCCGGCCCGATGGCGGCGGCGGCGG
2011.08.28