Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04509

HP ID(1) HP04509
Gene ID(2) 51319
Gene Symbol finder RSRC1
Protein Name arginine/serine-rich coiled-coil 1
RefSeq NM_016625.2
Length of RefSeq (bp) 1647
Chromosome 3q25.32
Reference DDBJ accession
UniGene Hs.591283

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa49B01 pKA1U5 GAAGTTCGGTGGACGCCGGCGGCGCCCTGATCTAAAGAAACGACTCAGGGACTGCGGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl