Prev. | 

RIKEN DNA Bank Human Resource - RSRC1

Gene ID NCBI Gene 51319 |  KEGG hsa:51319
Gene Symbol RSRC1
Protein Name arginine and serine rich coiled-coil 1
Synonyms BM-011|SFRS21|SRrp53
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086768 IRAL016P08 pDNR-LIB BC006982 NM_016625
HGY087794 IRAL019I02 pDNR-LIB BC010357 NM_016625 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE042888 W01A107D16 pENTR-TOPO IRAL016P08 BC006982 NM_016625  
HGE048145 W01A120G01 pENTR-TOPO IRAL016P08 BC006982 NM_016625  
HGE048147 W01A120G03 pENTR-TOPO IRAL016P08 BC006982 NM_016625  
HGE048149 W01A120G05 pENTR-TOPO IRAL016P08 BC006982 NM_016625  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR019625 ARa49B01 pKA1U5 NM_016625.2  
GAAGTTCGGTGGACGCCGGCGGCGCCCTGATCTAAAGAAACGACTCAGGGACTGCGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl