Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04507

HP ID(1) HP04507
Gene ID(2) 55062
Gene Symbol finder WIPI1
Protein Name WD repeat domain, phosphoinositide interacting 1
RefSeq NM_017983.5
Length of RefSeq (bp) 1939
Chromosome 17q24.2
Reference DDBJ accession
UniGene Hs.463964

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa48H11 pKA1U5 GACCCGGCCCGTGGAGCCGGCGCGGGCGGGCTGCTGAGGTGGCTGTCGCCGGCTCCGAGC
RBdS132N24 pGCAP10 GCCGTGGAGCCGGCGCGGGCGGGCTGCTGAGGTGGCTGTCGCCGGCTCCGAGCTGCGGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl