Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132N24

Clone ID RBdS132N24
HP ID HP04507
Gene ID 55062
Gene Symbol WIPI1
Protein Name WD repeat domain, phosphoinositide interacting 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_017983.5
Length of RefSeq (bp) 1939
Chromosome 17q24.2
Reference DDBJ accession
UniGene Hs.463964
5'-terminal sequence GCCGTGGAGCCGGCGCGGGCGGGCTGCTGAGGTGGCTGTCGCCGGCTCCGAGCTGCGGCT
2011.08.28