Prev. |  KEGG KO K17908 > 

RIKEN DNA Bank Human Resource - WIPI1

Gene ID NCBI Gene 55062 |  KEGG hsa:55062
Gene Symbol WIPI1
Protein Name WD repeat domain, phosphoinositide interacting 1
Synonyms ATG18|ATG18A|WIPI49
Featured content Autophagy (human)
Ortholog resource in our bank

  WIPI1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19630 pMXs-IP-GFP-WIPI1 Retroviral vector for stable expression of human WIPI1 with N-terminal EGFP.
RDB19788 pMXs-puro HA-WIPI-1 Retroviral vector for stable expression of human WIPI-1 with N-terminal HA.
RDB19790 pMXs-IP-GFP-Atg14 Retroviral vector for stable expression of human Atg14 with N-terminal EGFP.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033952 IRAK084O16 pCMV-SPORT6 BC039867 NM_017983 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR019379 ARa48H11 pKA1U5 NM_017983.5  
GACCCGGCCCGTGGAGCCGGCGCGGGCGGGCTGCTGAGGTGGCTGTCGCCGGCTCCGAGC
HKR453136 RBdS132N24 pGCAP10 NM_017983.5  
GCCGTGGAGCCGGCGCGGGCGGGCTGCTGAGGTGGCTGTCGCCGGCTCCGAGCTGCGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.29

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl