Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04470

HP ID(1) HP04470
Gene ID(2) 79621
Gene Symbol finder RNASEH2B
Protein Name ribonuclease H2, subunit B
RefSeq NM_024570.2
Length of RefSeq (bp) 1613
Chromosome 13q14.3
Reference DDBJ accession
UniGene Hs.306291

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS049G03 pGCAP10 GGGGCGGCATGGCCGCTGGCGTGGACTGCGGGGACGGGGTTGGCGCCCGGCAGCACGTGT
RBd34F11 pGCAP10 GATGGCCGCTGGCGTGGACTGCGGGGACGGGGTTGGCGCCCGGCAGCACGTGTTCCTGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl