Prev. |  KEGG KO K10744 > 

RIKEN DNA Bank Human Resource - RNASEH2B

Gene ID NCBI Gene 79621 |  KEGG hsa:79621
Gene Symbol RNASEH2B
Protein Name ribonuclease H2 subunit B
Synonyms AGS2|DLEU8
Ortholog resource in our bank

  RNASEH2B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027505 IRAK068M17 pCMV-SPORT6 BC036744 NM_024570 Partial/var
HGY081945 IRAL004O09 pOTB7 BC001397 NM_024570 Partial/var
HGY089682 IRAL024D10 pOTB7 BC007332 NM_024570 Partial/var
HGY091553 IRAL028O17 pOTB7 BC010174 NM_024570 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219747 ARiS049G03 pGCAP10 NM_024570.2  
GGGGCGGCATGGCCGCTGGCGTGGACTGCGGGGACGGGGTTGGCGCCCGGCAGCACGTGT
HKR373731 RBd34F11 pGCAP10 NM_024570.2  
GATGGCCGCTGGCGTGGACTGCGGGGACGGGGTTGGCGCCCGGCAGCACGTGTTCCTGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl