Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04464

HP ID(1) HP04464
Gene ID(2) 22902
Gene Symbol finder RUFY3
Protein Name RUN and FYVE domain containing 3
RefSeq NM_014961.3
Length of RefSeq (bp) 4282
Chromosome 4q13.3
Reference DDBJ accession
UniGene Hs.713172

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa43G09 pKA1U5 TTGGAGCGGCGGAGCCCAGGCGCCAGCCCGTGGCCGAGAAGAAAGGTGGCGGTGGCGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl