Prev. | 

RIKEN DNA Bank Human Resource - RUFY3

Gene ID NCBI Gene 22902 |  KEGG hsa:22902
Gene Symbol RUFY3
Protein Name RUN and FYVE domain containing 3
Synonyms RIPX|SINGAR1|ZFYVE30
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY036382 IRAK090P22 pBluescript BC051716 NM_014961
HGY098868 IRAL047C20 pOTB7 BC053837 NM_014961 Partial
HGY103302 IRAL058E06 pOTB7 BC071988 NM_014961 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE090838 M01C027B14 pDONR221 MGC03-D07 BC051716 NM_014961  
HGE090886 M01C027D14 pDONR221 MGC03-D07 BC051716 NM_014961  
HGE090934 M01C027F14 pDONR221 MGC03-D07 BC051716 NM_014961  
HGE090982 M01C027H14 pDONR221 MGC03-D07 BC051716 NM_014961  
HGE091030 M01C027J14 pDONR221 MGC03-D07 BC051716 NM_014961  
HGE091078 M01C027L14 pDONR221 MGC03-D07 BC051716 NM_014961  
HGE091126 M01C027N14 pDONR221 MGC03-D07 BC051716 NM_014961  
HGE091174 M01C027P14 pDONR221 MGC03-D07 BC051716 NM_014961  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR017353 ARa43G09 pKA1U5 NM_014961.3  
TTGGAGCGGCGGAGCCCAGGCGCCAGCCCGTGGCCGAGAAGAAAGGTGGCGGTGGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl