Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04414

HP ID(1) HP04414
Gene ID(2) 83695
Gene Symbol finder C12orf32
Protein Name chromosome 12 open reading frame 32
RefSeq NM_031465.2
Length of RefSeq (bp) 1872
Chromosome 12p13.33
Reference DDBJ accession
UniGene Hs.198853

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi07D06 pGCAP10 GGGCATTCCGGGCTCGAAGGCTGTGCGGTCTGCCAGGAGCTGCGGCCCCGTCCGGCCCGG
RBd94D05 pGCAP10 GCCGGGCTCGAAGGCTGTGCGGTCTGCCAGGAGCTGCGGCCCCGTCCGGCCCGGGCTGGT
RBdS104A08 pGCAP10 GGCATTCCGGGCTCGAAGGCTGTGCGGTCTGCCAGGAGCTGCGGCCCCGTCCGGCCCGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl