Prev. | 

RIKEN DNA Bank Human Resource - RHNO1

Gene ID NCBI Gene 83695 |  KEGG hsa:83695
Gene Symbol RHNO1
Protein Name RAD9-HUS1-RAD1 interacting nuclear orphan 1
Synonyms C12orf32|HKMT1188|RHINO
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082940 IRAL007F20 pOTB7 BC000079 NM_031465 Partial
HGY087442 IRAL018K02 pOTB7 BC005106 NM_031465 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162878 ARi07D06 pGCAP10 NM_031465.2  
GGGCATTCCGGGCTCGAAGGCTGTGCGGTCTGCCAGGAGCTGCGGCCCCGTCCGGCCCGG
HKR397677 RBd94D05 pGCAP10 NM_031465.2  
GCCGGGCTCGAAGGCTGTGCGGTCTGCCAGGAGCTGCGGCCCCGTCCGGCCCGGGCTGGT
HKR441608 RBdS104A08 pGCAP10 NM_031465.2  
GGCATTCCGGGCTCGAAGGCTGTGCGGTCTGCCAGGAGCTGCGGCCCCGTCCGGCCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl