Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04345

HP ID(1) HP04345
Gene ID(2) 51699
Gene Symbol finder VPS29
Protein Name vacuolar protein sorting 29 homolog (S. cerevisiae)
RefSeq NM_016226.3
Length of RefSeq (bp) 1089
Chromosome 12q24, deletion
Reference DDBJ accession
UniGene Hs.632735

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe65C02 pKA1U5 GGGAGCCTGAGGAAGAGGGCGGCGACGGTGGTCNTTACTGAGCGGAGCCCGGTGACAGGA
RBdS154O19 pGCAP10 GAGGAAGAGGGCGGCGACGGTGGTGGTGACTGAGCGGAGCCCGGTGACAGGATGGCTGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl