Prev. |  KEGG KO K18467 > 

RIKEN DNA Bank Human Resource - VPS29

Gene ID NCBI Gene 51699 |  KEGG hsa:51699
Gene Symbol VPS29
Protein Name VPS29 retromer complex component
Synonyms DC15|DC7|PEP11
Featured content Endocytosis (human)
Ortholog resource in our bank

  VPS29

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001778 IRAK004H10 pCMV-SPORT6 BC000880 NM_057180 Full
HGX025788 IRAK064H20 pCMV-SPORT6 BC032462 NM_057180
HGY094553 IRAL036G09 pDNR-LIB BC017964 NM_057180

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066050 ARe65C02 pKA1U5 NM_016226.3  
GGGAGCCTGAGGAAGAGGGCGGCGACGGTGGTCNTTACTGAGCGGAGCCCGGTGACAGGA
HKR461955 RBdS154O19 pGCAP10 NM_016226.3  
GAGGAAGAGGGCGGCGACGGTGGTGGTGACTGAGCGGAGCCCGGTGACAGGATGGCTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl