Prev. | Human A to Z list > V > 

RIKEN DNA Bank Human Resource - VPS29

Gene ID (NCBI) 51699
Gene Symbol VPS29
Protein Name vacuolar protein sorting 29 homolog (S. cerevisiae)
Synonyms DC15|PEP11
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001778 IRAK004H10 pCMV-SPORT6 BC000880 NM_057180 Full
HGX025788 IRAK064H20 pCMV-SPORT6 BC032462 NM_057180
HGY094553 IRAL036G09 pDNR-LIB BC017964 NM_057180

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066050 ARe65C02 pKA1U5 NM_016226.3  
GGGAGCCTGAGGAAGAGGGCGGCGACGGTGGTCNTTACTGAGCGGAGCCCGGTGACAGGA
HKR461955 RBdS154O19 pGCAP10 NM_016226.3  
GAGGAAGAGGGCGGCGACGGTGGTGGTGACTGAGCGGAGCCCGGTGACAGGATGGCTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl