Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04335

HP ID(1) HP04335
Gene ID(2) 65220
Gene Symbol finder NADK
Protein Name NAD kinase
RefSeq NM_023018.3
Length of RefSeq (bp) 3283
Chromosome 1p36.33-p36.21
Reference DDBJ accession
UniGene Hs.654792

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe92D05 pKA1U5 GGTCCGGGCGGCCATGGGGCAACAGGCGGCCAGGGCGCCAAGGGCCAGGTAGCGACGGCT
ARe93A06 pKA1U5 GGTCCGGGCGGCCATGGGGCAACAGGCGGCCAGGGCGCCAAGGGCCAGGTAGCGACGGCT
ARiS013O07 pGCAP10 GGTCCNNGNNNNCNTGNNNCNNTGGCGGCCAGGGCGCCAAGGGCCAGGTAGCGACGGCTG
RBd16E07 pGCAP10 GGTGGGCGGGCGCGGCGCATTGCTGCTCGGCGGCGCCGGCGCCGGGGTCCGGGCGGCCAT
RBd98C08 pGCAP10 GCCGGGCGGCCATGGGGCAACAGGCGGCCAGGGCGCCAAGGGCCAGGTAGCGACGGCTGG
RBdS022O17 pGCAP10 GGCGGCGCATTGCTGCTCGGCGGCGCCGGCGCCGGGGTCCGGGCGGCCATGGGGCAACAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl