Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022O17

Clone ID RBdS022O17
HP ID HP04335
Gene ID 65220
Gene Symbol NADK
Protein Name NAD kinase
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_023018.3
Length of RefSeq (bp) 3283
Chromosome 1p36.33-p36.21
Reference DDBJ accession
UniGene Hs.654792
5'-terminal sequence GGCGGCGCATTGCTGCTCGGCGGCGCCGGCGCCGGGGTCCGGGCGGCCATGGGGCAACAG
2011.08.28