Prev. |  KEGG KO K00858 > 

RIKEN DNA Bank Human Resource - NADK

Gene ID NCBI Gene 65220 |  KEGG hsa:65220
Gene Symbol NADK
Protein Name NAD kinase
Synonyms dJ283E3.1
Ortholog resources KEGG ortholog (KEGG orthology K00858) in the DNA Bank
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081410 IRAL003I18 pOTB7 BC022063 NM_023018 Partial/var
HGY083442 IRAL008K02 pOTB7 BC001709 NM_023018 Full/var
HGY085816 IRAL014I24 pOTB7 BC024219 NM_023018 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE032048 W01A080B24 pENTR-TOPO IRAL008K02 BC001709 NM_023018  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076877 ARe92D05 pKA1U5 NM_023018.3  
GGTCCGGGCGGCCATGGGGCAACAGGCGGCCAGGGCGCCAAGGGCCAGGTAGCGACGGCT
HKR077206 ARe93A06 pKA1U5 NM_023018.3  
GGTCCGGGCGGCCATGGGGCAACAGGCGGCCAGGGCGCCAAGGGCCAGGTAGCGACGGCT
HKR205543 ARiS013O07 pGCAP10 NM_023018.3  
GGTCCNNGNNNNCNTGNNNCNNTGGCGGCCAGGGCGCCAAGGGCCAGGTAGCGACGGCTG
HKR366503 RBd16E07 pGCAP10 NM_023018.3  
GGTGGGCGGGCGCGGCGCATTGCTGCTCGGCGGCGCCGGCGCCGGGGTCCGGGCGGCCAT
HKR399256 RBd98C08 pGCAP10 NM_023018.3  
GCCGGGCGGCCATGGGGCAACAGGCGGCCAGGGCGCCAAGGGCCAGGTAGCGACGGCTGG
HKR409153 RBdS022O17 pGCAP10 NM_023018.3  
GGCGGCGCATTGCTGCTCGGCGGCGCCGGCGCCGGGGTCCGGGCGGCCATGGGGCAACAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl