Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04293

HP ID(1) HP04293
Gene ID(2) 10567
Gene Symbol finder RABAC1
Protein Name Rab acceptor 1 (prenylated)
RefSeq NM_006423.1
Length of RefSeq (bp) 770
Chromosome 19q13.2
Reference DDBJ accession
UniGene Hs.11417

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi40D01 pGCAP10 GGTCGACTCCGCTGGGTGGGGCCGGCGTCGGGCGGGGCCGGCGGGGTCTTCAGGGTACCG
ARiS088O08 pGCAP10 GACGACGCAAACATGGCAGCGCAGAAGGACCAGCAGAAAGATGCCGAGGCGGAAGGGCTG
ARiS194P03 pGCAP10 GACAGCAGCTCTACCCCTCACGACGCAGACATGGCAGCGCAGAAGGACCAGCAGAAAGAT
ARiS198I18 pGCAP10 GACAGCAGCTCTACCCCTCACGACGCAGACATGGCAGCGCAGAAGGACCAGCAGAAAGAT
RBd34F10 pGCAP10 GACAGCAGCTCTACCCCTCACGACGCAGACATGGCAGCGCAGAAGGACCAGCAGAAAGAT
RBd54A11 pGCAP10 GGTCGACTCCGCTGGGTGGGGCCGGCGTCGGGCGGGGCCGGCNGNGTCTTCAGGGTACCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl