Prev. |  KEGG KO K20359 > 

RIKEN DNA Bank Human Resource - RABAC1

Gene ID NCBI Gene 10567 |  KEGG hsa:10567
Gene Symbol RABAC1
Protein Name Rab acceptor 1
Synonyms PRA1|PRAF1|YIP3
Ortholog resource in our bank

  RABAC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084375 IRAL010P15 pOTB7 BC008950 NM_006423 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098007 M01C045A07 pDONR221 MGC12-A04 BC008950 ENST00000222008  
HGE098055 M01C045C07 pDONR221 MGC12-A04 BC008950 ENST00000222008  
HGE098103 M01C045E07 pDONR221 MGC12-A04 BC008950 ENST00000222008  
HGE098151 M01C045G07 pDONR221 MGC12-A04 BC008950 ENST00000222008  
HGE098199 M01C045I07 pDONR221 MGC12-A04 BC008950 ENST00000222008  
HGE098247 M01C045K07 pDONR221 MGC12-A04 BC008950 ENST00000222008  
HGE098295 M01C045M07 pDONR221 MGC12-A04 BC008950 ENST00000222008  
HGE098343 M01C045O07 pDONR221 MGC12-A04 BC008950 ENST00000222008  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR176073 ARi40D01 pGCAP10 NM_006423.1  
GGTCGACTCCGCTGGGTGGGGCCGGCGTCGGGCGGGGCCGGCGGGGTCTTCAGGGTACCG
HKR235544 ARiS088O08 pGCAP10 NM_006423.1  
GACGACGCAAACATGGCAGCGCAGAAGGACCAGCAGAAAGATGCCGAGGCGGAAGGGCTG
HKR277963 ARiS194P03 pGCAP10 NM_006423.1  
GACAGCAGCTCTACCCCTCACGACGCAGACATGGCAGCGCAGAAGGACCAGCAGAAAGAT
HKR279410 ARiS198I18 pGCAP10 NM_006423.1  
GACAGCAGCTCTACCCCTCACGACGCAGACATGGCAGCGCAGAAGGACCAGCAGAAAGAT
HKR373730 RBd34F10 pGCAP10 NM_006423.1  
GACAGCAGCTCTACCCCTCACGACGCAGACATGGCAGCGCAGAAGGACCAGCAGAAAGAT
HKR381611 RBd54A11 pGCAP10 NM_006423.1  
GGTCGACTCCGCTGGGTGGGGCCGGCGTCGGGCGGGGCCGGCNGNGTCTTCAGGGTACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl