Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04155

HP ID(1) HP04155
Gene ID(2) 55781
Gene Symbol finder RIOK2
Protein Name RIO kinase 2 (yeast)
RefSeq NM_018343.1
Length of RefSeq (bp) 1832
Chromosome 5q15
Reference DDBJ accession
UniGene Hs.27021

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi08A08 pGCAP10 GACGCTTTGCGGCTGTCGTCGGAGAGGCATCTGGGTTCGGACTGGGGCCGCCATGGGGAA
RBd18C08 pGCAP10 GAGAGGCATCTGGGTTCGGACTGGGGCCGCCATGGGGAAAGTGAATGTGGCCAAGTTGCG
RBd70F05 pGCAP10 GGTCGGAGAGGCATCTGGGTTCGGACTGGGGCCGCCATGGGGAAAGTGAATGTGGCCAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl