Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RIOK2

Gene ID (NCBI) 55781
Gene Symbol RIOK2
Protein Name RIO kinase 2
Synonyms RIO2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04438 SEREX clone BRC-Co-30 #1 SEREX clone BRC-Co-30 #1

RDB_hum_161122.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001332 IRAK003F12 pCMV-SPORT6 BC000953 NM_018343 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163208 ARi08A08 pGCAP10 NM_018343.1  
GACGCTTTGCGGCTGTCGTCGGAGAGGCATCTGGGTTCGGACTGGGGCCGCCATGGGGAA
HKR367256 RBd18C08 pGCAP10 NM_018343.1  
GAGAGGCATCTGGGTTCGGACTGGGGCCGCCATGGGGAAAGTGAATGTGGCCAAGTTGCG
HKR388125 RBd70F05 pGCAP10 NM_018343.1  
GGTCGGAGAGGCATCTGGGTTCGGACTGGGGCCGCCATGGGGAAAGTGAATGTGGCCAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl