Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04056

HP ID(1) HP04056
Gene ID(2) 5866
Gene Symbol finder RAB3IL1
Protein Name RAB3A interacting protein (rabin3)-like 1
RefSeq NM_013401.2
Length of RefSeq (bp) 2305
Chromosome 11q12-q13.1
Reference DDBJ accession
UniGene Hs.13759

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb55A06 pGCAP1 GCCGCCCAGGGCAGGGTCGGGGCTGGGCTGGGGGCCGCGAGCCCAGGCGTCTGAGACCTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl