Prev. |  KEGG KO K16779 > 

RIKEN DNA Bank Human Resource - RAB3IL1

Gene ID NCBI Gene 5866 |  KEGG hsa:5866
Gene Symbol RAB3IL1
Protein Name RAB3A interacting protein like 1
Synonyms GRAB
Ortholog resource in our bank

  RAB3IL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010808 IRAK027A08 pCMV-SPORT6 BC022239 NM_013401
HGX044055 IRAK110C07 pCMV-SPORT6 BC051820 NM_013401 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092432 M01C031B08 pDONR221 MGC05-D04 BC022239 ENST00000335219  
HGE092480 M01C031D08 pDONR221 MGC05-D04 BC022239 ENST00000335219  
HGE092528 M01C031F08 pDONR221 MGC05-D04 BC022239 ENST00000335219  
HGE092576 M01C031H08 pDONR221 MGC05-D04 BC022239 ENST00000335219  
HGE092624 M01C031J08 pDONR221 MGC05-D04 BC022239 ENST00000335219  
HGE092672 M01C031L08 pDONR221 MGC05-D04 BC022239 ENST00000335219  
HGE092720 M01C031N08 pDONR221 MGC05-D04 BC022239 ENST00000335219  
HGE092768 M01C031P08 pDONR221 MGC05-D04 BC022239 ENST00000335219  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR342006 RBb55A06 pGCAP1 NM_013401.2  
GCCGCCCAGGGCAGGGTCGGGGCTGGGCTGGGGGCCGCGAGCCCAGGCGTCTGAGACCTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl