Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04028

HP ID(1) HP04028
Gene ID(2) 8480
Gene Symbol finder RAE1
Protein Name RAE1 RNA export 1 homolog (S. pombe)
RefSeq NM_003610.3
Length of RefSeq (bp) 1815
Chromosome 20q13.31
Reference DDBJ accession
UniGene Hs.371698

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe62G03 pKA1U5 GGCGCACGCGCGTTGTTTCCGCGGTAGTCAGGGCAGATTTCTACCGCAGGCTTAAGGAGG
RBdS110E16 pGCAP10 TGCCCGCGGTAGTCAGGGCAGTTTCTACCGCAGGCTTAAGGAGGCTTCGGGCTCCTGGGA
RBdS154I14 pGCAP10 ACGCNCGTTGTTTCCGCGGTAGTCAGGGCAGTTTCTACCGCAGGCTTAAGGAGGCTTCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl