Prev. |  KEGG KO K14298 > 

RIKEN DNA Bank Human Resource - RAE1

Gene ID NCBI Gene 8480 |  KEGG hsa:8480
Gene Symbol RAE1
Protein Name ribonucleic acid export 1
Synonyms Gle2|MIG14|MRNP41|Mnrp41|dJ481F12.3|dJ800J21.1
Ortholog resources KEGG ortholog (KEGG orthology K14298) in the DNA Bank
Featured content Influenza A relevant genes - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064947 ARe62G03 pKA1U5 NM_003610.3  
GGCGCACGCGCGTTGTTTCCGCGGTAGTCAGGGCAGATTTCTACCGCAGGCTTAAGGAGG
HKR444112 RBdS110E16 pGCAP10 NM_003610.3  
TGCCCGCGGTAGTCAGGGCAGTTTCTACCGCAGGCTTAAGGAGGCTTCGGGCTCCTGGGA
HKR461806 RBdS154I14 pGCAP10 NM_003610.3  
ACGCNCGTTGTTTCCGCGGTAGTCAGGGCAGTTTCTACCGCAGGCTTAAGGAGGCTTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl