Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RAE1

Gene ID (NCBI) 8480
Gene Symbol RAE1
Protein Name ribonucleic acid export 1
Synonyms MIG14|MRNP41|Mnrp41|dJ481F12.3|dJ800J21.1
Databases KEGG hsa:8480 |  NCBI Gene 8480
Featured content Ortholog resources in the DNA Bank (KEGG orthology K14298)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064947 ARe62G03 pKA1U5 NM_003610.3  
GGCGCACGCGCGTTGTTTCCGCGGTAGTCAGGGCAGATTTCTACCGCAGGCTTAAGGAGG
HKR444112 RBdS110E16 pGCAP10 NM_003610.3  
TGCCCGCGGTAGTCAGGGCAGTTTCTACCGCAGGCTTAAGGAGGCTTCGGGCTCCTGGGA
HKR461806 RBdS154I14 pGCAP10 NM_003610.3  
ACGCNCGTTGTTTCCGCGGTAGTCAGGGCAGTTTCTACCGCAGGCTTAAGGAGGCTTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl