Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03961

HP ID(1) HP03961
Gene ID(2) 7469
Gene Symbol finder WHSC2
Protein Name Wolf-Hirschhorn syndrome candidate 2
RefSeq NM_005663.3
Length of RefSeq (bp) 2466
Chromosome 4p16.3
Reference DDBJ accession
UniGene Hs.21771

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd82D10 pGCAP10 GGCTTTCCCCCAAGATGGCGTCCATGCGGGAGAGCGACACGGGCCTGTGGCTGCACAACA
RBdS154D21 pGCAP10 GGCGCTTTCCCCCAAGATGGCGTCCATGCGGGAGAGCGACACGGGCCTGTGGCTGCACAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl