Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154D21

Clone ID RBdS154D21
HP ID HP03961
Gene ID 7469
Gene Symbol WHSC2
Protein Name Wolf-Hirschhorn syndrome candidate 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005663.3
Length of RefSeq (bp) 2466
Chromosome 4p16.3
Reference DDBJ accession
UniGene Hs.21771
5'-terminal sequence GGCGCTTTCCCCCAAGATGGCGTCCATGCGGGAGAGCGACACGGGCCTGTGGCTGCACAA
2011.08.28