Prev. |  KEGG KO K15179 > 

RIKEN DNA Bank Human Resource - NELFA

Gene ID NCBI Gene 7469 |  KEGG hsa:7469
Gene Symbol NELFA
Protein Name negative elongation factor complex member A
Synonyms NELF-A|P/OKcl.15|WHSC2
Ortholog resources KEGG ortholog (KEGG orthology K15179) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085150 IRAL012O14 pOTB7 BC002764 NM_005663 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037455 W01A093K15 pENTR-TOPO IRAL012O14 BC002764 NM_005663 done
HGE046234 W01A115J18 pENTR-TOPO IRAL012O14 BC002764 NM_005663 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR392882 RBd82D10 pGCAP10 NM_005663.3  
GGCTTTCCCCCAAGATGGCGTCCATGCGGGAGAGCGACACGGGCCTGTGGCTGCACAACA
HKR461693 RBdS154D21 pGCAP10 NM_005663.3  
GGCGCTTTCCCCCAAGATGGCGTCCATGCGGGAGAGCGACACGGGCCTGTGGCTGCACAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl