Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03951

HP ID(1) HP03951
Gene ID(2) 51634
Gene Symbol finder RBMX2
Protein Name RNA binding motif protein, X-linked 2
RefSeq NM_016024.2
Length of RefSeq (bp) 1528
Chromosome Xq26.1
Reference DDBJ accession
UniGene Hs.718487

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi59H11 pGCAP10 GATTCCTGAGTGCTGAGCGCGAACCCGAGGAGATGAACCCTTTAACTAAGGTGAAGCTGA
RBb46H11 pGCAP1

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl