Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RBMX2

Gene ID (NCBI) 51634
Gene Symbol RBMX2
Protein Name RNA binding motif protein, X-linked 2
Synonyms CGI-79|Snu17
Databases KEGG hsa:51634 |  NCBI Gene 51634
Featured content Ortholog resources in the DNA Bank (KEGG orthology K13107)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR183779 ARi59H11 pGCAP10 NM_016024.2  
GATTCCTGAGTGCTGAGCGCGAACCCGAGGAGATGAACCCTTTAACTAAGGTGAAGCTGA
HKR338579 RBb46H11 pGCAP1 NM_016024.2  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl