Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03841

HP ID(1) HP03841
Gene ID(2) 7443
Gene Symbol finder VRK1
Protein Name vaccinia related kinase 1
RefSeq NM_003384.2
Length of RefSeq (bp) 1720
Chromosome 14q32
Reference DDBJ accession
UniGene Hs.422662

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS049O15 pGCAP10 GAGAACGCNACGGGTCTGCGGCTTAGGTGAAAATGCCTCGTGTAAAAGCAGCTCAAGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl