Prev. | Human A to Z list > V > 

RIKEN DNA Bank Human Resource - VRK1

Gene ID (NCBI) 7443
Gene Symbol VRK1
Protein Name vaccinia related kinase 1
Synonyms PCH1|PCH1A
Databases KEGG hsa:7443 |  NCBI Gene 7443
Featured content Ortholog resources in the DNA Bank (KEGG orthology K08816)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR219951 ARiS049O15 pGCAP10 NM_003384.2  
GAGAACGCNACGGGTCTGCGGCTTAGGTGAAAATGCCTCGTGTAAAAGCAGCTCAAGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl