Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03816

HP ID(1) HP03816
Gene ID(2) 6237
Gene Symbol finder RRAS
Protein Name related RAS viral (r-ras) oncogene homolog
RefSeq NM_006270.3
Length of RefSeq (bp) 1013
Chromosome 19q13.3-qter2
Reference DDBJ accession
UniGene Hs.515536

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe08G09 pKA1U5 GATGAGCAGCGGGGCGGCGTCCGGGACAGGGCGGGGGCGGCCCCGGGGCGGGGGACCTGG
ARe39A11 pKA1U5 TGGCAGGCGGTAGCGAAGGCAGCAGCAGCGGTGGCGACATGAGCAGCGGGGCGGCGTCCG
ARiS088B23 pGCAP10 GAGGCGGTAGCGAAGGCAGCAGCAGCGGTGGCGACATGAGCAGCGGGGCGGCGTCCGGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl