Prev. |  KEGG KO K07829 > 

RIKEN DNA Bank Human Resource - RRAS

Gene ID NCBI Gene 6237 |  KEGG hsa:6237
Gene Symbol RRAS
Protein Name RAS related
Synonyms R-Ras
Featured content Axon guidance - human
Featured content Mitophagy - human
Ortholog resource in our bank

  RRAS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006161 IRAK015G17 pCMV-SPORT6 BC016286 NM_006270 Full
HGY093101 IRAL032M13 pDNR-LIB BC016318 NM_006270 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113642 M01C084B18 pDONR221 IMS05-H09 BC016318 NM_006270  
HGE113690 M01C084D18 pDONR221 IMS05-H09 BC016318 NM_006270  
HGE113738 M01C084F18 pDONR221 IMS05-H09 BC016318 NM_006270  
HGE113786 M01C084H18 pDONR221 IMS05-H09 BC016318 NM_006270  
HGE113834 M01C084J18 pDONR221 IMS05-H09 BC016318 NM_006270  
HGE113882 M01C084L18 pDONR221 IMS05-H09 BC016318 NM_006270  
HGE113930 M01C084N18 pDONR221 IMS05-H09 BC016318 NM_006270  
HGE113978 M01C084P18 pDONR221 IMS05-H09 BC016318 NM_006270  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043353 ARe08G09 pKA1U5 NM_006270.3  
GATGAGCAGCGGGGCGGCGTCCGGGACAGGGCGGGGGCGGCCCCGGGGCGGGGGACCTGG
HKR055611 ARe39A11 pKA1U5 NM_006270.3  
TGGCAGGCGGTAGCGAAGGCAGCAGCAGCGGTGGCGACATGAGCAGCGGGGCGGCGTCCG
HKR235247 ARiS088B23 pGCAP10 NM_006270.3  
GAGGCGGTAGCGAAGGCAGCAGCAGCGGTGGCGACATGAGCAGCGGGGCGGCGTCCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl