Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03643

HP ID(1) HP03643
Gene ID(2) 5883
Gene Symbol finder RAD9A
Protein Name RAD9 homolog A (S. pombe)
RefSeq NM_004584.2
Length of RefSeq (bp) 2128
Chromosome 11q13.1-q13.2
Reference DDBJ accession
UniGene Hs.655354

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe53C04 pKA1U5 GGGTCGCGGAGAGCTGGGCAGTGTTGGCCGCTGGCGNAGCGCTGGGGCAGCATGAAGTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl