Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RAD9A

Gene ID (NCBI) 5883
Gene Symbol RAD9A
Protein Name RAD9 homolog A (S. pombe)
Synonyms RAD9
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA damage


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02959 pEF-3xHA-Rad9 Expression vector of HA-tagged human Rad9

RDB_hum_161122.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX011356 IRAK028G12 pCMV-SPORT6 BC014848 NM_004584 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE017949 W01A044O13 pENTR-TOPO IRAK028G12 BC014848 NM_004584  
HGE017953 W01A044O17 pENTR-TOPO IRAK028G12 BC014848 NM_004584  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR061252 ARe53C04 pKA1U5 NM_004584.2  
GGGTCGCGGAGAGCTGGGCAGTGTTGGCCGCTGGCGNAGCGCTGGGGCAGCATGAAGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.01.23

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl