Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03634

HP ID(1) HP03634
Gene ID(2) 112936
Gene Symbol finder VPS26B
Protein Name vacuolar protein sorting 26 homolog B (S. pombe)
RefSeq NM_052875.3
Length of RefSeq (bp) 3685
Chromosome 11q25
Reference DDBJ accession
UniGene Hs.334684

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe78D08 pKA1U5 GGCCGAAGCGCCTCGGTGCGTTGCACCGCCGGAGGCTGGGCAGCTCGCAGCGCTGCTCGG
RBd08E08 pGCAP10 GGCCCCCTCCCCCGCCCGGAGCCGCCGAAGCGCCTCGGTGCGTTGCACCGCCGGAGGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl