Prev. |  KEGG KO K18466 > 

RIKEN DNA Bank Human Resource - VPS26B

Gene ID NCBI Gene 112936 |  KEGG hsa:112936
Gene Symbol VPS26B
Protein Name VPS26, retromer complex component B
Synonyms Pep8b
Ortholog resources KEGG ortholog (KEGG orthology K18466) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085884 IRAL014L20 pOTB7 BC009747 NM_052875 Full
HGY088145 IRAL020G01 pOTB7 BC007799 NM_052875
HGY092249 IRAL030K09 pOTB7 BC014128 NM_052875 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071280 ARe78D08 pKA1U5 NM_052875.3  
GGCCGAAGCGCCTCGGTGCGTTGCACCGCCGGAGGCTGGGCAGCTCGCAGCGCTGCTCGG
HKR363304 RBd08E08 pGCAP10 NM_052875.3  
GGCCCCCTCCCCCGCCCGGAGCCGCCGAAGCGCCTCGGTGCGTTGCACCGCCGGAGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl