Prev. | Human A to Z list > V > 

RIKEN DNA Bank Human Resource - VPS26B

Gene ID (NCBI) 112936
Gene Symbol VPS26B
Protein Name vacuolar protein sorting 26 homolog B (S. pombe)
Synonyms Pep8b
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY085884 IRAL014L20 pOTB7 BC009747 NM_052875 Full
HGY088145 IRAL020G01 pOTB7 BC007799 NM_052875
HGY092249 IRAL030K09 pOTB7 BC014128 NM_052875 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071280 ARe78D08 pKA1U5 NM_052875.3  
GGCCGAAGCGCCTCGGTGCGTTGCACCGCCGGAGGCTGGGCAGCTCGCAGCGCTGCTCGG
HKR363304 RBd08E08 pGCAP10 NM_052875.3  
GGCCCCCTCCCCCGCCCGGAGCCGCCGAAGCGCCTCGGTGCGTTGCACCGCCGGAGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl